precut nitrocellulose filter paper sandwiches (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
93
Structured Review
Bio-Rad
precut nitrocellulose filter paper sandwiches
Precut Nitrocellulose Filter Paper Sandwiches, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 176 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/precut+nitrocellulose+filter+paper+sandwiches/Nitrocellulose%2FFilter+Paper+Sandwiches/pmc07100051-133-101-105
Average 93 stars, based on 176 article reviews
Precut Nitrocellulose Filter Paper Sandwiches, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 176 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/precut+nitrocellulose+filter+paper+sandwiches/Nitrocellulose%2FFilter+Paper+Sandwiches/pmc07100051-133-101-105
Average 93 stars, based on 176 article reviews
precut nitrocellulose filter paper sandwiches - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Expressing:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Control:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Sequencing:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Western Blot:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Polyacrylamide Gel Electrophoresis:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: .. SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Membrane:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: .. SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Molecular Weight:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: .. SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using High Molecular Weight:Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: Purified miRNA (1,000 ng) was converted to cDNA using miScript cDNA synthesis kit (Qiagen) following the manufacturer’s protocol. qRT-PCR was performed with miRNA-specific primers (Qiagen) using miScript SYBR Green PCR master mix (Qiagen) and CFX96 thermal cycler (Bio-Rad). .. Ct values for the selected gene were normalized against RNU6–2 (internal miR expression control) values in the same sample. table ft1 table-wrap mode="anchored" t5 Table caption a7 Target Species Sequence 5′–3′ MCP-1 F Mus musculus GTAGCAGCAGGTGAGTGGGGC MCP-1 R Mus musculus CACAGTTGCCGGCTGGAGCAT IL-1β F Mus musculus CCTCGGCCAAGACAGGTCGC IL-1β R Mus musculus TGCCCATCAGAGGCAAGGAGGA 18SF Mus musculus TTCGAACGTCTGCCCTATCAA 18SR Mus musculus ATGGTAGGCACGGCGATA CD68F Mus musculus AGGGTGGAAGAAAGGTAAAGC CD68R Mus musculus AGAGCAGGTCAAGGTGAACAG F4/80F Mus musculus TTTCCTCGCCTGCTTCTTC F4/80R Mus musculus CCCCGTCTCTGTATTCAACC Open in a separate window showing the primer sequences for the different targets genes: Western blot SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using Article Title: MICROCYSTIN EXPOSURE WORSENS NONALCOHOLIC FATTY LIVER DISEASE ASSOCIATED ECTOPIC GLOMERULAR TOXICITY VIA NOX-2-MIR21 AXIS Article Snippet: .. SDS PAGE-Resolved protein bands were transferred to nitrocellulose membrane using |